Which of the following is required as inducer(s) for the expression of Lac operon?

A complex of ribosomes attached to a single strand of RNA is known as

Which of the following is not required for any of the techniques of DNA fingerprinting available at present?

Which one of the following is the starter codon?

During DNA replication, Okazaki fragments are used to elongate

The final proof for DNA as the genetic material came from the experiments of

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?

Which of the following RNAs should be most abundant in an animal cell?

The experimental proof for semiconservative replication of DNA was first shown in a

All of the following are part of an operon except

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as

Which of the following statements is correct?

Which of the following is correct about viroids?

Name the enzyme that facilitates opening of DNA helix during transcription.

If the distance between two consecutive base pairs is $0.34$ nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is $6.6 \times 10^9$ bp, then the length of the DNA is approximately:

The first phase of translation is:

DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as:

Complete the flow chart on central dogma.

Identify the correct statement.

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

Which of the following RNAs is not required for the synthesis of protein?

Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation, and Termination in the process of transcription in prokaryotes?

Statement I: $,\newline$The codon ‘AUG’ codes for methionine and phenylalanine. $\newline$Statement II: $,\newline$‘AAA’ and ‘AAG’ both codons code for the amino acid lysine. $\newline$In the light of the above statements, choose the correct answer from the options given below.

Read the following statements and choose the set of correct statements: $\newline$ $\newline$(a) Euchromatin is loosely packed chromatin $\newline$(b) Heterochromatin is transcriptionally active $\newline$(c) Histone octamer is wrapped by negatively charged DNA in nucleosome $\newline$(d) Histones are rich in lysine and arginine $\newline$(e) A typical nucleosome contains 400 bp of DNA helix $\newline$ $\newline$Choose the correct answer from the options given below:

Unequivocal proof that DNA is the genetic material was first proposed by:

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

Expressed Sequence Tags (ESTs) refers to:

Upon exposure to UV radiation, DNA stained with ethidium bromide will show:

Match List I with List II:

Given below are two statements: $\newline$Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. $\newline$Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. $\newline$Choose the correct answer from the options given below:$$

Given below are two statements: $\newline$Statement I: RNA mutates at a faster rate. $\newline$Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. $\newline$Choose the correct answer from the options given below:$$

Which one of the following is the sequence on the corresponding coding strand, if the sequence on mRNA formed is as follows: 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

Which one is the correct product of DNA dependent RNA polymerase to the given template? $\newline$3'TACGGCAAATACCTTAC5'