Did you know?
Mitochondria have their own DNA ā evidence they were once independent bacteria absorbed by early cells.
Did you know?
Mitochondria have their own DNA ā evidence they were once independent bacteria absorbed by early cells.
Which one of the following is the sequence on the corresponding coding strand, if the sequence on mRNA formed is as follows: 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
5'UAGCUAGCUAGCUAGCUAGCUAGCUAGC UAGC 3'
3'UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
5'ATCGATCGATCGATCGATCGATCGATCG 3'
3'ATCGATCGATCGATCGATCGATCGATCG 5'
To solve this problem, we need to determine the sequence on the coding strand of DNA that corresponds to the given mRNA sequence.The mRNA sequence provided is:AUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGLet's break down the steps to find the corresponding coding strand:The coding strand of DNA has the same sequence as the mRNA, except that thymine (T) replaces uracil (U).Therefore, the sequence on the coding strand will be:ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGNow, let's compare this sequence with the given options:Option 1: 5'UAGCUAGCUAGCUAGCUAGCUAGCUAGC UAGC 3' - This is not the correct sequence as it contains uracil (U).Option 2: 3'UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' - This is not the correct sequence as it is in the reverse direction and contains uracil (U).Option 3: 5'ATCGATCGATCGATCGATCGATCGATCG 3' - This matches the sequence we derived for the coding strand.Option 4: 3'ATCGATCGATCGATCGATCGATCGATCG 5' - This is in the reverse direction.Therefore, the correct option is Option 3.
More practice, more score
Use hints to get start solving
Ask any question, get instant answers
Get detailed step by step solutions
Read while solving
Improve every day