Molecular Basis of Inheritance

Top concepts asked in NEET

Swipe left/right or use arrow keys to navigate

DNA Replication

DNA $_{new} =$ DNA $_{parental} +$ DNA $_{new}$

Semiconservative replication where each new DNA molecule consists of one parental and one newly synthesized strand.

Terms:

DNA $_{$ new $}$

Newly synthesized DNA strand

DNA $_{$ parental $}$

Original DNA strand

The process by which DNA makes a copy of itself during cell division. It involves the separation of the two strands and the synthesis of new complementary strands.

Common Use:

Understanding genetic inheritance and mutations.

Practice Related Questions

DNA

Genetics

Replication

1 of 5.

Click on a card to view the details.

Practice Questions

NEET Questions

1. Which of the following shows coiled RNA strand and capsomeres?

2. Which one of the following is wrongly matched?

3. Transformation was discovered by

4. Viruses have

5. Select the correct option: Direction of RNA synthesis / Direction of reading of the template DNA strand

6. Commonly used vectors for human genome sequencing are

7. In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine. The percentages of the other three bases expected to be present in this DNA are

8. DNA is not present in

9. Gene regulation governing lactose operon of E. coli that involves the lac I gene product is

10.

Which of the following is required as inducer(s) for the expression of Lac operon?

11.

A complex of ribosomes attached to a single strand of RNA is known as

12.

Which of the following is not required for any of the techniques of DNA fingerprinting available at present?

13.

Which one of the following is the starter codon?

14. The association of histone H1 with a nucleosome indicates

15. DNA fragments are

16. DNA replication in bacteria occurs

17.

During DNA replication, Okazaki fragments are used to elongate

18.

The final proof for DNA as the genetic material came from the experiments of

19.

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?

20.

Which of the following RNAs should be most abundant in an animal cell?

21.

The experimental proof for semiconservative replication of DNA was first shown in a

22.

All of the following are part of an operon except

23.

AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?

24.

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as

25. Purines found both in DNA and RNA are

26. Which of the following features of the genetic code allows bacteria to produce human insulin by recombinant DNA technology?

27. Expressed Sequence Tags (ESTs) refers to:

28. Match the following genes of the Lac operon with their respective products:

29. Under which of the following conditions will there be no change in the reading frame of the following mRNA sequence? 5'AACAGCGGUGCUAUU3'

30.

Which of the following statements is correct?

31.

Which of the following is correct about viroids?

32.

Name the enzyme that facilitates opening of DNA helix during transcription.

33.

If the distance between two consecutive base pairs is $0.34$ nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is $6.6 \times 10^9$ bp, then the length of the DNA is approximately:

34.

The first phase of translation is:

35.

DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as:

36.

Complete the flow chart on central dogma.

37.

Identify the correct statement.

38.

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:

39.

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

40.

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

41.

Which of the following RNAs is not required for the synthesis of protein?

42.

Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation, and Termination in the process of transcription in prokaryotes?

43. Which one of the following statements about Histones is wrong?

44.

Statement I: $,\newline$ The codon ‘AUG’ codes for methionine and phenylalanine. $\newline$ Statement II: $,\newline$ ‘AAA’ and ‘AAG’ both codons code for the amino acid lysine. $\newline$ In the light of the above statements, choose the correct answer from the options given below.

45. The process of translation of mRNA to proteins begins as soon as:

46. DNA polymorphism forms the basis of:

47.

Read the following statements and choose the set of correct statements: $\newline$ $\newline$ (a) Euchromatin is loosely packed chromatin $\newline$ (b) Heterochromatin is transcriptionally active $\newline$ (c) Histone octamer is wrapped by negatively charged DNA in nucleosome $\newline$ (d) Histones are rich in lysine and arginine $\newline$ (e) A typical nucleosome contains 400 bp of DNA helix $\newline$ $\newline$ Choose the correct answer from the options given below:

48. If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called:

49. In an E. coli strain, the i gene gets mutated, and its product cannot bind the inducer molecule. If the growth medium is provided with lactose, what will be the outcome?

50. If the length of a DNA molecule is 1.1 meters, what will be the approximate number of base pairs?

51. Ten E. coli cells with ¹⁵N - dsDNA are incubated in a medium containing ¹⁴N nucleotides. After 60 minutes, how many E. coli cells will have DNA totally free from ¹⁵N?

52.

Unequivocal proof that DNA is the genetic material was first proposed by:

53.

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

54.

Expressed Sequence Tags (ESTs) refers to:

55.

Upon exposure to UV radiation, DNA stained with ethidium bromide will show:

56.

Match List I with List II:

57.

Given below are two statements: $\newline$ Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. $\newline$ Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. $\newline$ Choose the correct answer from the options given below:

58.

Given below are two statements: $\newline$ Statement I: RNA mutates at a faster rate. $\newline$ Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. $\newline$ Choose the correct answer from the options given below:

59.

Which one of the following is the sequence on the corresponding coding strand, if the sequence on mRNA formed is as follows: 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?

60. The lactose present in the growth medium of bacteria is transported to the cell by the action of:

61. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

62. The DNA present in chloroplast is:

63. Which of the following statement is correct regarding the process of replication in E. coli?

64.

Which one is the correct product of DNA dependent RNA polymerase to the given template? $\newline$ 3'TACGGCAAATACCTTAC5'

65. Match List I with List II: